Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST452140
Clone ID OST452140
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST452140
Sequence
GACTGAGGTTATGAGAAGACAGATGATGTTTCAGAGAAGACCTCGCTGGCAGATCAGGAGGAAGTGAGAACCATCTTCAT
CAACCAGCCTCAGCTGACAAAATTCTGCAACAACCACGTCAGTACTGCAAAATACAACGTGATCACATTCCTTCCGAGGT
TCCTCTATTCTCAGTTCCGAAGAGCGGCTAATTCGTTCTTTCTCTTTATTGCCCTGCTCCAGCAAATTCCTGATGTGTCG
CCGACCGGTCGTTACACAACACTGGTTCCTCTCTTATTTATTTTAGCTGTGGCTGCTATTAAAGAGATAATAGAAGATAT
TAAACGACACAAGGCTGATAATGCTGTGAACAAGAAACAGACACAAGTTTTGAGAAATGGTGCATGGGAAATTGTTCACT
GGGAAAAGGTAAATGTTGGAGATATAGTTATAATAAAAGGCAAAGAGTATATACCTGCTGACACTGTCCTTCTCTCGTCA
AGGTAGAGACACCTA
Sequence Type mRNA
Unitrap ID UNI16938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 68172214..68205964 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037685 (Atp8a1) NM_009727 ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1 Gene [Source:MGI (curated);Acc:Atp8a1-001]

 
Come back to gene ENSMUSG00000037685


For any suggestions or comments, please send an email to unitrap@crg.es