Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10102F4
Clone ID IST10102F4
Vector VICTR76
Project tigm

Sequence tag IST10102F4BBR1
Sequence
CAAGCTGGTACAACTTCTCTGGAAATCTGTCTGGCGGTTCCTCAGAAAATTGGACATAGTAGTACCTGAGGACCCAGCAA
TACCACTTCTGGACATATATCCAGAAGATGCTCCAACATGAAATAAGGGCACATGCTCCACTATGTTCATTGCAGCCTTA
TTTATAATAGCCAGAAGCTGGAAAGAGCACAGATGTCCTTCAACAGAGGAATGGATACAGAAAATGTGGTACATTTACAC
GATGGAGTACTACTCAGCTATTAAAAACAATGACTTCATGAAATTCACAGGCAAATGGATGGAACTTGAAAATATCATCC
TGAGTGAGGAAAAGAACACACAAGGTATGTGTTCACTGATAAGTAGATATTACCCCCAAAATCTGGAATAACCAAGATTC
AATTCACAGACTATATGAAGCTCAAGAAGGAAGACCAAAATGTGGATGCTTCAGGGATTCTTAGAAGGGTTAACAAAATA
CAGGAAATATGGAGGAAATATGGAGACAAAGTGTGGAGCAGAGATGGTAGGAAAAGGCCATCCAGAAACTGCCCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35667470..35668024 552
NO GENE  


Sequence tag IST10102F4HMF1
Sequence
CTTGCAATCCCACCAACAATGGAGGAATGTTCCTCTTTCTTTACATCCTTGCCANCATCTGCTGTCACCTGAATTTTTAA
TCTTAGCCGTTCTGACTGGTGTGAGGTAGAATCTCAGGGTTGTTTTGATTTCCCTTGATGACTAANGATGTTGAACATTT
CTTTCTTTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI12465

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35668021..35668208 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037400 (Atp11b) NM_029570 ATPase, class VI, type 11B Gene [Source:MGI (curated);Acc:Atp11b-001]

 
Come back to gene ENSMUSG00000037400


For any suggestions or comments, please send an email to unitrap@crg.es