Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14716C4
Clone ID IST14716C4
Vector VICTR76
Project tigm

Sequence tag IST14716C4HMR1
Sequence
NTGAGGGGCCTCCGTGGCTCACCCTGGTTTTCTCCNCAGTGCCTTCCCGAAGCCTACTGTTCTACGATGATGGGGCAGGC
TCATGGGAAGATGGCCGAGGTGCTCTACTGCCTGTGGAGCCCCCANAAGGCTGGGAGCTCAAACCCGGGGGTCCAGCAGA
GCAGAGGCCCCAGGACCACCTCCGACATGACCGTGCANACAGCATCCATGANACCACCAAGTACTTGAGAGAGACCTGGC
CN
Sequence Type genomic DNA
Unitrap ID UNI21893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91823388..91823627 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027230 (Creb3l1) NM_011957 cAMP responsive element binding protein 3-like 1 Gene [Source:MGI (curated);Acc:Creb3l1-001]


Sequence tag IST14716C4BBF1
Sequence
CAGGTATGTGCCCTCTGCCGGATCTGCTTCATTCACTTGCCGGGCATGAAGAGTACAGCCTCTGACATCTTACAGGCTTG
ACTCCTCCTCCTAGCCCTGAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91823626..91823730 105
NO GENE  

 
Come back to gene ENSMUSG00000027230


For any suggestions or comments, please send an email to unitrap@crg.es