Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11040B8
Clone ID IST11040B8
Vector VICTR76
Project tigm

Sequence tag IST11040B8BBF1
Sequence
GAGACCACTTTGCAAGAATCCTCCAAATAATGCCCCCCCTAGCAGCTTCCTCCTCCCCACTACCATGATTTAATAAAATA
AAGGTCCCCTGAAACAAGCCTCACATTTCTGTCCGTTCCGCCCCAAACCCCTTTTGAGTCTCGGGCTGCCATTCCCGCTA
CTTTCTGAGTTCCAAGTCCACTCGACTCCAGCAAGCCTCCCGACCGGGGACTGAGCCCCTTTCCCCCCCGCACCTACCTC
GTGGATCT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109416796..109417042 247
 
EST/CDNA Est Name
  BY340457.1 - BY233376.1 - BY343334.1 - CJ078907.1 - CJ088200.1 - CJ158670.1 - CJ084476.1 - BY091692.1 - BY325910.1 - CJ131577.1 - BY085088.1 - BY020739.1 - BY326034.1 - BY019108.1 - BY342914.1 - BY788690.1


Sequence tag IST11040B8HMF2
Sequence
TCCCCATCNTNCTGAAGCAGCTGGNCTGATT

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11040B8HMR1
Sequence
GACNNGTGTATTCCATGATCGTGGGCCCACTGTCGAACTTCTCTGGCTGTGAAATGAGTTCCTTGGTCAGAAGCAATACT
GTGTGGAATACCATGACGATAGATGAGGCATTCTGTCAATCCGTGAATGGTGGTTTTAGCAGAGGCATTACGTGCAGGAA
AGGCAAATCCATAACCAGAATAAGTATCTACTCCAGTAAGAACAAAACGCTGTCCTTTCCACGAAGGAAGTGGTCCAATG
TANTCC
Sequence Type genomic DNA
Unitrap ID UNI15448 UNI23657 UNI31842 UNI33249

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6150436..6150680 239
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 33914958..33915202 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073126 (AC132312.4) NM_028139 Ataxin-7-like protein 1 (Ataxin-7-like protein 4) [Source:UniProtKB/Swiss-Prot;Acc:Q9CZ05]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 76216090..76216334 239
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 59922196..59922440 239
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 96384887..96385131 239
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 46977145..46977389 239
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23824365..23824609 239
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 81497911..81498155 239
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20349884..20350128 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 131592949..131593193 239
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 116598489..116598733 239
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 127048833..127049077 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038028 (9630033F20Rik) NM_177003 RIKEN cDNA 9630033F20 gene Gene [Source:MGI Symbol;Acc:MGI:2442752]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 132443321..132443565 239
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127371359..127371603 239
 
EST/CDNA Est Name
  BB856728.1 - BY078978.1 - BF123697.1 - AA209773.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 186251..186495 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079190 (AC133103.5-205) A530032D15Rik protein [Source:UniProtKB/TrEMBL;Acc:Q52KL8]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 106465193..106465437 239
NO GENE  

 
Come back to gene ENSMUSG00000079190


For any suggestions or comments, please send an email to unitrap@crg.es