Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14278C4
Clone ID IST14278C4
Vector VICTR74
Project tigm

Sequence tag IST14278C4HMR1
Sequence
GCAGTAATTTTTAGGATCCTAAAAGGGTCCTGAAACCCAAAAATTAGTTGTTTTCAAGCTGAAGAGTTGGCAGGTCGGTT
AANAAAACTTGCTGCTCTTATAGAGGATCTTGGTTCAATTCCCAGCACTTACATGGCTGCTCAAGCATCTGTAACTCTAG
TTCTAGTTGATCCACTGGCTTCTCTGACTTCCCAGGGTACCAGGTACACATGGGGTACACATANAAGCAAATCCATGCTT
AACACATAAGTAACAAAATAAATAANTCTAAAAATTGTTTAAAGTTGTTCTCTAGGGCTTGGTTTGGGGCCTTGGAAACT
TGCATGTGGGGTANGGGTGN
Sequence Type genomic DNA
Unitrap ID UNI30226

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 167914691..167915029 331
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026565 (Pou2f1) NM_011137 POU domain, class 2, transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:101898]

 
Come back to gene ENSMUSG00000026565


For any suggestions or comments, please send an email to unitrap@crg.es