Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14012G7
Clone ID IST14012G7
Vector VICTR74
Project tigm

Sequence tag IST14012G7HMF1
Sequence
NCTTCTGTTCCNNCCCCCANTTANNAAAACTTTAAAACATGTATTTACATATTTGTGTGTGTTGTGCCATGGCNNAGGGC
AGGCTGCANGAATCNATCATCCTTCACTACNTGGGTCTCANGGATCNAACTCANGTCTCCANCTTTGGCTACAAGTGCTT
TTATCCNCTGAGCCCTCTCAAAAGTTCTTTCTTTTCCTTCTCNTNCNAGCTCTCTTTTAANGGGAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14012G7HMR1
Sequence
AACCGATTGGGACAGGAAGAACATACAGTCGCATTGCTGATTCCTTCNTGTCNGAGACACGAGTAGTAGGACTTCCCATA
GGGAAAAATGATTAGGGTTGAGACTGTAGTTCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI27555

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12358928..12359043 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023827 (Agpat4) NM_026644 1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) Gene [Source:MGI Symbol;Acc:MGI:1915512]

 
Come back to gene ENSMUSG00000023827


For any suggestions or comments, please send an email to unitrap@crg.es