Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10056F2
Clone ID IST10056F2
Vector VICTR75
Project tigm

Sequence tag IST10056F2BBF1
Sequence
GCCATCTCCTCTGAGGCGAAGGTCTACAGCTTAGTGAGCACCTCGCTCCTCTGAAGACTAGAGCTCCAGAGTGAGAGAGC
TACAGGGAAGCGGGGCTGGCTAGTCCCTTGGCTGGCCTGACTGACATACATCAGACCCTGGCTGCCCTGGGTATAGAAGC
AACTCTGAACTTGTCCATGCTAGGCAGATGTGCCTAGCAGGGTTCTAACAGGAAGCAGCTGCAGGGTGGCTTGTGCTGCT
GCCGGTGACACAAATGTCATCAGGGCCTCAAGAAGGTCAGTTCCCGCCGGGCAGTGGTGGTGCATGCCTTTAATCCCAGC
ACTTGGGAGGCAGAGGCAGGAGGATTTCTGAGTTTGAGGCCGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTA
CATCAGAGAAACACTGTGCTCGAAAAAAGAGGTCGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165634736..165635168 418
 
EST/CDNA Est Name
  DV066041.1 - AI427345.1 - CK622678.1 - CF170213.1 - BM963753.1 - BG805534.1 - AW762466.1 - BM963846.1 - W49202.1 - CN660086.1 - CF950191.1 - BG802683.1 - CA570430.1 - CA570198.1 - BI986813.1


Sequence tag IST10056F2HMF1
Sequence
GCCNTCTCCTCTGAGGCGAAGGTCTACAGCTTAGTGAGCACCTCGCTCCTCTGAAGACTAGAGCTCCAGAGTGAGAGAGC
TACAGGGAAGCGGGGCTGGCTAGTCCCTTGGCTGGCCTGACTGACATACATCAGACCCTGGCTGCCCTGGGTATAGAAGC
AACTCTGAACTTGTCCATGCTAGGCAGATGTGCCTAGCAGGGTTCTAACAGGAAGCAGCTGCAGGGTGGCTTGTGCTGCT
GCCGGTGACACAAATGTCATCAGGGCCTCAAGAAGGTCAGTTCCCGCCGGGCAGTGGTGGTGCATGCCTTTNNNCCANCA
CTTGGGANGCANNNGCANGNNGATTTCTGAGNTNGANGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10056F2BBR1
Sequence
TGGCAACTCTTCTCTTCTTCTCCTTGGCTTCTTGTAACCCGAAGCTTGCTCAAGATCC
Sequence Type genomic DNA
Unitrap ID UNI15535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165634682..165634739 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es