Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10223H10
Clone ID IST10223H10
Vector VICTR76
Project tigm

Sequence tag IST10223H10BBF1
Sequence
AGAGCACCCGACTGCTCTTCCNAAGGTCTGGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCACCAGTAATGAG
ATCTGT
Sequence Type genomic DNA
Unitrap ID UNI5947 UNI9915 UNI30191

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 38138973..38139057 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 59376410..59376494 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059586 (Nsmce2) NM_026746 non-SMC element 2 homolog (MMS21, S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915751]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 82379651..82379735 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11662701..11662785 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018654 (Ikzf1) NM_009578 IKAROS family zinc finger 1 Gene [Source:MGI (curated);Acc:Ikzf1-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72608456..72608540 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56580639..56580723 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122652293..122652377 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25705648..25705732 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143652027..143652111 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066640 (Fbxl18) NM_001033312 F-box and leucine-rich repeat protein 18 Gene [Source:MGI (curated);Acc:Fbxl18-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 132717692..132717776 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 151917727..151917811 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 52094441..52094525 79
NO GENE  


Sequence tag IST10223H10HMF2
Sequence
AGAGCACCCGACTGCTCTTCCAAAGGTCTGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCACCAGTAATGAG
ATCTGACTCTCTCTTCTGGAGTGTCGGAAGACAGCTACAGTGTACTTACATATAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI30759

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 125067575..125067724 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025551 (Fgf14) NM_010201 fibroblast growth factor 14 Gene [Source:MGI (curated);Acc:Fgf14-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25705583..25705732 146
NO GENE  

 
Come back to gene ENSMUSG00000025551


For any suggestions or comments, please send an email to unitrap@crg.es