Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14934H4
Clone ID IST14934H4
Vector VICTR76
Project tigm

Sequence tag IST14934H4HMF1
Sequence
GGGAGGCAGAGGCAGGCNNATTTCTGAGTTGGAGATCAGCCTGGTCTACAGAGTTCCAGGACAGCCNGAGCTACACAGAG
AAACCTTGTCTCGAAAAACCAAAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGGAAGGAAGGA
AGGAAGGAAGGAAGGAAGGAAGGAAGGANNAAAGANNGAACNAAAGAAAGATGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14934H4HMR1
Sequence
NTCNGACACTGGGGAACTTGAGAGATTGTGTGATCACGTACACTTGAGTAAGGGCTCACTATTGCTCTTATAGACTGTGA
AGTGTTTTCTGATCTAGAATTGTTTTTTCTTGTTCTCTGTTCTCCTTTTTGTGGTTGTGAGGAATGAAGCCACTGCCTCA
CTAAACATGGGCGTCTCTTACCAGGTCTGTTGGGTAGTTCACGGTTCTTGCTTTGCTCTTTACATCNNANCACTTTTTCT
TGGTTTTTGGTTTTGTTTTTTTGTTTGCTTGGTTGGTTTTTTGGTN
Sequence Type genomic DNA
Unitrap ID UNI20932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75394666..75394949 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058587 (Tmod3) NM_016963 tropomodulin 3 Gene [Source:MGI Symbol;Acc:MGI:1355315]

 
Come back to gene ENSMUSG00000058587


For any suggestions or comments, please send an email to unitrap@crg.es