Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0492
Clone ID GC0492
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0492
Sequence
CTGTATCATTCTCTCTCCCTCCCTCTTGGGAAAGAGCAGTCCCTGAGGTGGCAGAGGACATGGAACTGGCGGGCAGGTAT
CCAGTGTCTGTT
Sequence Type mRNA
Unitrap ID UNI297

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42805657..42805748 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059495 (Arhgef12) NP_081420 Rho guanine nucleotide exchange factor (GEF) 12 Gene [Source:MGI Symbol;Acc:MGI:1916882]

 
Come back to gene ENSMUSG00000059495


For any suggestions or comments, please send an email to unitrap@crg.es