Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST451896
Clone ID OST451896
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST451896
Sequence
TCTGAGAGCCCTTTGGTGCTACNTTTTCTGAGCATCTGGATGNCTCTGCANATGNNGGGGTACTACTNNNNTNTCTGAAG
ACANCTACAGCAGTCCTCATATCANNGTNTNCNNANNTACNGGANNNANNATNGACCCAGGNGTCAATNGTGACATGTTT
CAGTAATGCTGCAACCCTTTGATTATGATCCAGAATGAAAAGAGTAAACATANGTTCATGGTACAGACAATTTTTGCTCC
ACCAAACATTTCAGATATGGAAGCTGTGTGGAAAGAAGCAAAACCTGATGAATTAATGGATTCTAAATTGAGATGTGTGT
TTGAAATGCCGAATGAAAATGATAAGCTGAATGATATGGAACCTAGCAAAGCTGTTCCACTGAATGCATCCAAACAAGAC
GGACCCCTGCCAAAACCACACAGTGTTTCACTCAATGATACGGAAACAAGGAAACTGATGGAAGAGTGCAAGCGACTCCA
GGGAGAAATGATGAA
Sequence Type mRNA
Unitrap ID UNI3071

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 65931948..65942888 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024091 (Vapa) NM_013933 vesicle-associated membrane protein, associated protein A Gene [Source:MGI Symbol;Acc:MGI:1353561]

 
Come back to gene ENSMUSG00000024091


For any suggestions or comments, please send an email to unitrap@crg.es