Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14730D7
Clone ID IST14730D7
Vector VICTR76
Project tigm

Sequence tag IST14730D7HMR1
Sequence
CTCAACTAAACACAGAAAATGTTTTCTTTTCCCTGTTTTGAGTCACAGTCTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71122888..71122941 54
NO GENE  


Sequence tag IST14730D7HMF1
Sequence
GAGGAAGCATTGTTATTGACTTCTGTTTTTTCCTTCNNCNGNGTCATCTNGGTGGANGTACNNNGNTATCTATCNNATTA
NCNCTTTGGTTTGAATTTCTCTAATATTGANTTANGTTTCCNGTGTCNCCGGGGCAATTGNNTANANAGTGTTNATTCNC
NTTATTTGCCCTTTTTANAAAANTTGNACTTTTTGTTCTTTGGTTATTCANTATTTTAAAAATTCTTTGTATATTCNGTA
CNCCAAATCTTTANCAAATTNAAATATNATTTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14730D7BBF1
Sequence
GAGGAAGCATTGTTATTGACTTCTGTTTTTTCCTTCTACTGTGTCATCTTGGTGGATGTACAGTGGTATCTATCTCATTA
GCGCTTTGGTTTGAATTTCTCTAATATTGAGTTATGTTTCCTGTGTCTCCTGGGCAATTGTATAGAGAGTGTTTATTCAC
GTTATTTGCCCTTTTTATAGAAATTGGACTTTTTGTTCTTTGGTTATTCAATATTTTAAGAATTCTTTGTATATTCTGTA
CACCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI22725

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71122939..71123188 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003279 (Dlgap1) NM_177639 discs, large (Drosophila) homolog-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1346065]

 
Come back to gene ENSMUSG00000003279


For any suggestions or comments, please send an email to unitrap@crg.es