Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14865F3
Clone ID IST14865F3
Vector VICTR76
Project tigm

Sequence tag IST14865F3HMF1
Sequence
GACCTACAGGGATGTGTCCACATTCCCAGCCTGGCCCTCTGGGTCATGAGGCCATGGGATGTAAGCCCCTTAGCATAGAG
AAGAGGCGATACACAGAGATGGCCCCTCTCCCTTTCTAGCTGTAACACATTCACTCTGCCAGTGGGCANCAGGGCAGTGC
TTTGAAGATCTCCCNNCTTCTATAGTTGCNTGGNGCTGN
Sequence Type genomic DNA
Unitrap ID UNI27686

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97660811..97661008 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031788 (Kifc3) NP_034761 kinesin family member C3 Gene [Source:MGI Symbol;Acc:MGI:109202]

 
Come back to gene ENSMUSG00000031788


For any suggestions or comments, please send an email to unitrap@crg.es