Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14513C6
Clone ID IST14513C6
Vector VICTR74
Project tigm

Sequence tag IST14513C6HMR1
Sequence
NTGTTAATACTACCNGGAATGAATTGATTCTTTAGCCTCACTGTGGAAACATGAACTGCTTGTTGATGTGTAGGGTATCT
TAATTGGCATTGGCATTGGCATGCAGTTTGCCAGCACCTGTTCAGTCCAGGATGTTTTTAATACACTCTGTTTCAAACGC
CTGCACTGCACANGTTANTCATGTGACANACTCNTGCCTCAGANTCATGGGGTTAAATGGAACACCANTACTGTTTTCCT
GCTNANGTTANNAAA
Sequence Type genomic DNA
Unitrap ID UNI15801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107759094..107759342 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es