Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10923H6
Clone ID IST10923H6
Vector VICTR76
Project tigm

Sequence tag IST10923H6HMR1
Sequence
NTTTAATAGAGTCNTANNGATTTTTCNCCNTTNNNCNNTGTGACCAGCCATTCTAACTCAATCTTAGACTGGTCCTAATA
TTCAGTCCAATGTTAGAGATTCCTATATTCTAAATTACCTAGCAAGTTAATTCAGAGCACATCCCCCACTTCCCCTAGAT
CCCTAACTTCAGAAGGATTGCTGGCCTTACAGCTAGTGAAAAAAGCTATTAAAGAGCAATTGGTCACTTAATACATTGGT
AAAATAGAAGGACCCCCTGACTAACAAATGGAAGGGTCCAGATCCAGTTCTAATTTGGGGTAGGGACTCAGTTTGTGTTT
TNNCACGAGATGAAGATAGAGCACAGTGGCTGCCANATAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157414623..157414980 332
 
EST/CDNA Est Name
  AW907873.1 - BI466577.1 - BE291329.1 - BE554335.1 - CA534766.1 - BY387126.1 - CA984699.1 - BY383299.1 - BB728049.1 - CJ224298.1 - BB710342.1 - CJ206418.1 - CJ207152.1 - AW228330.1 - AA607934.1 - BF100436.1 - CA536388.1 - CA536506.1 - CA536353.1


Sequence tag IST10923H6BBF1
Sequence
CAGTCTCTGATGTACTATTGCCATAAAGTTAAAAGGCTAGAAGCTAGTCTAAACTGGAAAAATGACAAGTAAGGATGGAT
CTAAAACATGAATTTAATTTAGTTTTTTAGTCNATTAAATCAGGACATGAGTCAACTTACCTACCAGCTCGTCACACGAA
TTTACTAATATGCTTCTGCAGCGTTCTGTGGAGAAAACCTGTTTTTCCCTTTTTTAATAAGGTAGTTGTTTTAGGATTAA
TCTATNANCNNATAANTNNATCCCTTTAAGATACTATAAAGCATTTATNANNCTCTTTGACATTAAAAATATTANATTTT
GAAAATNANGGTAAGACTTTAATAGTGTGCATGGGAATGCACTNNNNAGCATGCACGGGGATACAATTTCTCTCTTTTTT
GTCTTTTAANAANTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10923H6HMF2
Sequence
CAGTCTCTGATGTACTATTGCCATAAAGTTAAAAGGCTAGAAGCTAGTCTAAACTGGAAAAATGACAAGTAAGGATGGAT
CTAAAACATGAATTTAATTTAGTTTTTTAGTCAATTAAATCAGGACATGAGTCAACG

Sequence Type genomic DNA
Unitrap ID UNI31033

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44897901..44898036 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157414460..157414595 136
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3253826..3253961 136
NO GENE  

 
Come back to gene ENSMUSG00000071856


For any suggestions or comments, please send an email to unitrap@crg.es