Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12440B8
Clone ID IST12440B8
Vector VICTR76
Project tigm

Sequence tag IST12440B8BBF1
Sequence
CCATGCTCTCGTAGACTGGAGGTCCGCTGCTAACAAACACAGTGACAGAGTAAATATGGCACCAAGGTTATTTAN
Sequence Type genomic DNA
Unitrap ID UNI18155

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21693950..21694023 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028251 (2610029I01Rik) RIKEN cDNA 2610029I01 gene Gene [Source:MGI Symbol;Acc:MGI:1924282]


Sequence tag IST12440B8HMF1
Sequence
CCATGCTCTCGTAGACTGGAGGTCCGCTGCTAACAAACACAGTGACAGAGTAAATATGGCACCAAGGTTATTTATAAAGA
GAATGAATTGTGCAAGTTTGAGTGATGAANGN
Sequence Type genomic DNA
Unitrap ID UNI18155

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21693915..21694023 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028251 (2610029I01Rik) RIKEN cDNA 2610029I01 gene Gene [Source:MGI Symbol;Acc:MGI:1924282]

 
Come back to gene ENSMUSG00000028251


For any suggestions or comments, please send an email to unitrap@crg.es