Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10823C3
Clone ID IST10823C3
Vector VICTR76
Project tigm

Sequence tag IST10823C3HMF1
Sequence
CCACCACTGCCTGTCCCATACACAGTTGAATGATTTCCTGGCACCCANAATGTTGCCTGGGAGGCCTCTCTTCACAGTAG
AGTTCCTGTGTGCGCCATGTACATGGTAGCTTGTGACAGGACTGGCCCTTGGGAGAGCAAAGCCATCCTGTTGAGCTTAC
CGAGCACATGGCCTGCTGCTGCCTTCCT
Sequence Type genomic DNA
Unitrap ID UNI23372

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124501837..124502008 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025316 (Banp) NM_016812 BTG3 associated nuclear protein Gene [Source:MGI Symbol;Acc:MGI:1889023]

 
Come back to gene ENSMUSG00000025316


For any suggestions or comments, please send an email to unitrap@crg.es