Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14956F9
Clone ID IST14956F9
Vector VICTR76
Project tigm

Sequence tag IST14956F9BBF1
Sequence
TGGGGCAGCAGAGATGGTTCAGTGGTTAAGAGCACTGGCTGCTCTTCCAAAGGTCCCAGGTATGATTCCCAGCACCCATA
TTGTAGCTCAAAACCATTTGTAACTCCAGTTTCAGGGAATCTGACTCTCCTGGCTCCTGTGGGCACCAGGCACATACATC
ACTGGTGCACAGTCATACATACAGACAAAGCACCCACACACATAAAATAACAAATTAAAAATTTTCTCATTGGTGTCTTT
TATTTTAGATACACCTTTCACATACTTTCATACTTCGTCAGTATTATATCCACAAGCATGCACCCNTGCTCCAATAAAGC
CNCTNTAAAGACNAANAACACTTTAAAAATTATCTNTGTNNNTGGGCTGGANAGANGGCTCANCGGCTAANAGTNNTGAC
TGGCTGGNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 134374828..134375233 376
NO GENE  


Sequence tag IST14956F9HMR1
Sequence
CCCTCAGTGAGATAANTTTTCTGCTATGCCAAAATGTGGATATTGTAATAAAGAGGATAACCAANAGTTTAAGTTGATGA
TGTTTATTTTGTGGAGACTCATGGATGCCAGGTTGGACAGTTTACTTTTTAAGGAAGATAGGGCAGATACACCANCNNCT
CANATGGANCNCTGATTTATAAAGTTTTTCGGAGAGTTATAATGCATAGATGAATGTTGANACAATATANAACCNGTCTG
GAAGGCCACAATGTATGAGTGATACACGGANTGTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14956F9HMF2
Sequence
ATGTGACGGCAGAACACTCTAATCANAGGCCAANCAAGTANGAAGGCTGTANGGCCCGTTCCTGCCAAGGCCTGGGGTGT
TTGAGGAACAGTGTATCTACCATAGTGTGAGCAAAGGTAGTGAGGGCCAAAGTATGGAGAGAAAATGTCAAAACAACAAC
TCCAGCAACACAAACAAACAAACAAAACAAAAGGCAGGGGAGCCCACACATAGGGTCTTGTGGA
Sequence Type genomic DNA
Unitrap ID UNI30876

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 86556914..86557136 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038007 (Asah3l) NM_139306 N-acylsphingosine amidohydrolase 3-like Gene [Source:MGI (curated);Acc:Asah3l-001]

 
Come back to gene ENSMUSG00000038007


For any suggestions or comments, please send an email to unitrap@crg.es