Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10336H1
Clone ID IST10336H1
Vector VICTR76
Project tigm

Sequence tag IST10336H1HMF2
Sequence
GCGGGACAAGCCACTTCCTGAGGTTACACGCTTAGGTGGCCGCCCGCCCTCCAGAATGACACCAGGTTTTACCAACTGAA
AGGGGTCACGGAGCTGGCTTAGAAGTGTGGTCACGCTAGGCAACCCTCTCAAGACATCAAGAATTTCAGAATTAAAATTC
TTCCGAGAATGTGGAATATTTGAGACTCGATAGGACCATGATTTATGAAACTATTACCAAGAGTTCTATGAAACAGGTAN
TGTTTTTAAATGTGTGGTGCAAGGAGAACTCTGCAGCCAGGCGACAGGACCCGGGTATTTGATACTCTATAAATCTCTCT
TTGAAATGCTGCATAAGATTCTTTTTCCCCTTTCTNACTATGTGCTGTTGTAGATGGCTCTTGTAGCTAGCTATTCGCTG
TATNATTAAAAGAGCACTGAAAAAGANAAACTAACATTTCGTAGATTCAGCATATTNATAATTNAAACTTATAGTTCCTA
ATGATGTCCATAANGCTTTATAATCCTTANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73536448..73536956 495
 
EST/CDNA Est Name
  BB624892.1


Sequence tag IST10336H1BBF1
Sequence
CGAACTTAGATCACGAGAGCCTTCTTGAAGTGCAGCCACATGCANACATGAAGAGCATCTGCAGATTCAAGAAACAGGAA
AGGGACAAACATGGAACCTAGGAGCCAGCGCCTCAGCACACCGGAGCTCATTAACACTGGGTCCTAACAGTGTGGTGCTC
ACAGAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI2261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100237754..100237924 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es