Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST451439
Clone ID OST451439
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST451439
Sequence
CACCAAGTACATTCGTAGAGCTTTTTAAAAATATTTTGTGGAATTGTATTTATGAGAATCTTGTGGTTAATATAAAGATT
TTAAAATATTCTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI5085

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 137537902..137537994 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030850 (Ate1) NM_001029895 arginyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1333870]

 
Come back to gene ENSMUSG00000030850


For any suggestions or comments, please send an email to unitrap@crg.es