Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14669A5
Clone ID IST14669A5
Vector VICTR74
Project tigm

Sequence tag IST14669A5HMF1
Sequence
CTANTGGACTGCTTTNNCCAGTATAAGCTTTGGGATACAAAGTGGTTACTTAAGANAGCAGACAGACAACTCAAGANNGG
AAACAGCCNACAAGCCCCTCTGACTAAGANCTGACACTCACAAGACAGTCACTGANCAATAGAAGCAGCCGCTCCTCCAA
GANAACGTATTTCNNGGATGGTAATATTTTCTTCNNCTTGGTTGATCGGGATGCCAACAGACAGCCNACATCATCAGNNC
AGGNACTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14669A5HMR1
Sequence
CTAGTGGATTGAAGGAATCTTTGATCTTAAATACTTACAATCAGTAAAATTCCTAGGCAGCATCTTTGAAAATAACATTT
ATCTGGAAAGATGCCAATGCATTGCAGAAACATATAAGCTTCTTTAAAAGGGCAGGGGGGGTGGCGGCAAGAAAATATGA
AAACCTGGATTAGAAAAAAATANACTTGTTGCGTTGCGAACACATTCNCTGTTTCTGCTTTGCTTTTTTGANACTGATTA
TCACTGAGTTAAGGCTGGTCTTGAATTCATTTTCCNAGAATGANCNGGANCTCCTGATCCTGCCCCCGCCTCCCANTTGA
NAGCTGGGATTACAGATATGCACACACCNTANCTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI1457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121132812..121133169 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053931 (Cnn3) NM_028044 calponin 3, acidic Gene [Source:MGI Symbol;Acc:MGI:1919244]

 
Come back to gene ENSMUSG00000053931


For any suggestions or comments, please send an email to unitrap@crg.es