Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10890C6
Clone ID IST10890C6
Vector VICTR76
Project tigm

Sequence tag IST10890C6HMR1
Sequence
NNAATGGGACATTCGATCTAACTACTTAAAGAGGTTTTGCAGCCCTGGATCTCCCCGGGATAGGGTACCAGGACAGAGCC
GAGCCCGGCAGGTAGACCCATCCAGCTGGCTAGCTTGAGAAGTATGTGTTCCTTCTTGATATCTTATTCACAGTTGTCTT
ANCTTCTTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117033734..117033903 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST10890C6BBF1
Sequence
ACCTTTGGGCAATTCTCTGTAGATTTCCTGCGGCAAAGCTTGTGCAAACAAAGACAATGCATTAAGAAAATTAAGTTATA
AAATCCTTATCCTGGAAACTAAGCTTTATCANCTGTGTGCATTTGGAAAGAATATAAGAAGCTGCCCTCTAATTTAGGAT
CTACATTTTCCCAAAAAGTAAGAAAAAACAAGTATAAACATTTCTCTCTTCAAGCACATCTCAGAGCCCCTNTAAACATG
CACTTTCCCATCTAATTATAAAAGACACTCGTGTCTAAAAGAACTAATTAACATTTATGACATACATCTGTATGTAACTC
TTGAACCTNTGGGTTCTNAGTGGTTCTAGAAATGANACCTGATGACTCAGCAACTTCACTGNTGNCTGTCTCACTGGGGA
GACAGTGGCANCCTCTGACTCAGCTNANCAACCAGAAGCTTTTACNAGTNATAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 58468980..58469432 429
 
EST/CDNA Est Name
  CF909724.1 - BU609785.1 - CF906678.1 - CN720128.1 - CN724990.1 - CN724688.1 - CA579616.1 - CN724405.1 - CN724093.1 - CN723562.1 - AA396522.1 - CN719908.1 - CN720422.1 - CN660580.1 - CN665920.1 - CN720704.1 - CN716436.1 - CN724143.1 - CN718205.1 - CN718872

 
Come back to gene CF909724.1 - BU609785.1 - CF906678.1 - CN720128.1 - CN724990.1 - CN724688.1 - CA579616.1 - CN724405.1 - CN724093.1 - CN723562.1 - AA396522.1 - CN719908.1 - CN720422.1 - CN660580.1 - CN665920.1 - CN720704.1 - CN716436.1 - CN724143.1 - CN718205.1 - CN718872


For any suggestions or comments, please send an email to unitrap@crg.es