Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12012E1
Clone ID IST12012E1
Vector VICTR76
Project tigm

Sequence tag IST12012E1BBF1
Sequence
CTCCCCTCTCCAGAGTCCCATGTAGCCCAGGCTACCCTTGAGTTCACACAGCACTCAACCACTGGAGAACATGAGTTCAG
TCCTCTCTCCCACAAAAAAAGCTGGGTGCAGCAGCATACACCTATAACAGGAGACCCCTACTGCTCACTGGCAGTCAGCT
TAGTCAATAGGCAAGCTATGGGCTCGGGAAGGGAGAGGTGTGGATGGTCACTGCCAGACAGGCCTCANTGGAAGGAACAT
AGCTGAGGAAGAAGAGATTTGCTGACGACCTCTGTCTANCTTCCACAGGTCTGCATACACGCCACACACAAGGAATGTCC
CCCACTAACACCCAGCTTGTTTTATTTCTTTTGCCAGCATCCACTCCTGCTCCCTTATCCTGGTCTGTGANGTTCCTGTC
TTTCTCTGGCCNATTCCNCCACCATCCACCCCGCCCTTTGANGAANCAGACACCCCACTGTGGACACCTGGTCCTCTGCC
CTCTGTAACTGTGTGCGTGAACATCTTTGTGCTGGGTCTGTGTCGTGGGAATGACTGAN
Sequence Type genomic DNA
Unitrap ID UNI25402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57015154..57015691 524
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024209 (1700061G19Rik) NM_030141 RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]


Sequence tag IST12012E1HMF1
Sequence
CTCCCCTCTCCAGANTCCCATGTAGCCCAGGCTACCCTTGAGTTCACACAGCACTCAACCACTGGAGAACATGAGTTCAG
TCCTCTCTCCCACAAAAAAAGCTGGGTGCAGCAGCATACACCTATAACAGGAGACCCCTACTGCTCACTGGCAGTCAGCT
TANTCAATAGGCAAGCTATGGGCTCGGGAAGGGAGAGGTGTGGATGGTCACTGCCAGACAGGCCTCAATGGAAGGAACAT
AGCTGAGGAAGAAGAGATTTGCTGACGACCTCTGTCTAGCTTCCACAGGTCTGCATACACGCCACACACAAGGAATGTCC
CCCACTAACACCCAGCTTGTTTTATTTCTTTTGCCNGCATCCACTCCTGCTCCCTTATCCTGGTCTGTGANGTTCCTGTC
TTTCTCTGGA
Sequence Type genomic DNA
Unitrap ID UNI25402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57015154..57015562 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024209 (1700061G19Rik) NM_030141 RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]

 
Come back to gene ENSMUSG00000024209


For any suggestions or comments, please send an email to unitrap@crg.es