Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11889B9
Clone ID IST11889B9
Vector VICTR76
Project tigm

Sequence tag IST11889B9HMF1
Sequence
GAAGGAATAAAATACTAAATCTTGTAATCAGAAGGATGTCATTACCTTGATTGTGGAGATAGATAGTCTCACAAGTATAT
CCATGCTTCAGAACTACAGTCTACCGTCTAAATATGCACTTTANTATGCCTTTTAATTTTTAAGTCCTCATGTAATAGTT
TGATTAATCTTTTTTAGCTTCATTTACNAATCANTACAAGTAAAAAATTANCACCTAAATTGAAATGTTTTAGGTAAAAT
GCAAAATAATTTTAATGGCCTTTTTTGGGGATTCTTTTTGTTGTTTTTTTGTTNGTTTTAAGACAGGGTCGATCTATGTA
GTCTTGTCTGCCCTGAAACTTGCTATGTANACNNNCTAGCTTCAAACTAGAGATCTGCCTGCCTCTACCTCTAGAGCACT
GGGATTAATTCACCATCANACCTGGCTNANATTTNACAAATGTAAANAAAGTATCTTTATAGTCNTTTATTGTGTTGAGC
NNATGTTGGAANATTTACAATGAAATGTATATTTGGTGAAAAATCTNNNTTAAACNCTTCCNGTTTTCCCTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11889B9BBF1
Sequence
GAAGGAATAAAATACTAAATCTTGTAATCAGAAGGATGTCATTACCTTGATTGTGGAGATAGATAGTCTCACAAGTATAT
CCATGCTTCAGAACTACAGTCTACCGTCTAAATATGCACTTTANTATGCCTTTTAATTTTTAAGTCCTCATGTAATAGTT
TGATTAATCTTTTTTAGCTTCATTTACAAATCANTACAAGTAAAAAATTANCACCTAAATTGAAATGTTTTANGTAAAAT
GCAAAATAATTTTAATGGCCTTTTTTGGGGATTCTTTTTGTTGTTTTTTTGTTTGTTTTAAGACNGGGTCGATCTATGTA
NTCTTGTCTGCCCTGAAACTTGCTATGTANACCANCTAGCTTCAAACTAGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI14106

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40218057..40218433 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071014 (Ndufb6) NM_001033305 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6 Gene [Source:MGI (curated);Acc:Ndufb6-001]

 
Come back to gene ENSMUSG00000071014


For any suggestions or comments, please send an email to unitrap@crg.es