Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XP0019
Clone ID XP0019
Vector pGT0lxf
Project sanger

Sequence tag XP0019
Sequence
AGGATATTTGCCAGCAATCTCAGTATCTGGGAGACTGAAACAGAAGGATGCAAGTNTCAGGCCAGTCCTGGATACAGTGT
GAGGCTGTGTCAACCACAAAAACAAGGGTGAAGACTTTTTCACAACAGGGGTTTTTTTTTAGAGCTCTCCTTTCTCACCC
CAGAAGCCCGGATGTAGGCTGTGGATAATCGTTCGCTGGAGAGCCCTTCTCCATTCTCTCGGTGTTGGGGAGCACCTCTT
CTATGAGCGATTTTTCTCGACGATGAG
Sequence Type genomic DNA
Unitrap ID UNI536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114439012..114439117 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079259 (Trim71) NM_001042503 tripartite motif-containing 71 Gene [Source:MGI Symbol;Acc:MGI:2685973]

 
Come back to gene ENSMUSG00000079259


For any suggestions or comments, please send an email to unitrap@crg.es