Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13384C9
Clone ID IST13384C9
Vector VICTR74
Project tigm

Sequence tag IST13384C9HMF1
Sequence
ACCTTTCGCCATCTGGTAATCTCTGGAGTTAGTAGTTATAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 91514523..91514566 44
NO GENE  


Sequence tag IST13384C9BBF1
Sequence
NCCTTTCNCCATCTGGTAATCTCTGGAGTTANTANTTATAGTTGACTCTGTTTANAGATTGTTCTTCTGGTGATTCTGTT
ACCGTCTATCAGCAGACCTGGGAGACAGATTCTCTCCTCTGAGTTTCAGTGCTCAAAGCACTCTCTGCTGGCAAGCTCTC
TTACAGGGAAGGTGCGCAGATATCTTGTATTTGGACCTCCTCCTGGCCGAAGAANAAGGCCCAAAACAGGACCTTTCTCA
GACACTGTGTTGCTTTGGCAGTTCCCAGGTGGTACANACTCTCACCTAANCNNACTAAATTCCTAAGTTCCTTGGAGTCC
CGGGACCNAGATGGCNACCGCTGCTGCTGTGGCTN
Sequence Type genomic DNA
Unitrap ID UNI15140 UNI15225 UNI30676 UNI30809 UNI30810 UNI31952

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4551058..4551410 329
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5255567..5255919 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019769 (Syne1) NM_022027 synaptic nuclear envelope 1 Gene [Source:MGI Symbol;Acc:MGI:1927152]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7826427..7826779 329
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9689648..9690000 329
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3110124..3110476 329
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 7461936..7462288 329
 
EST/CDNA Est Name
  AI156842.1 - CB320405.1 - BY097334.1 - AI151859.1 - BU840088.1 - BI112273.1 - BY135240.1 - AW209547.1 - BY101325.1 - CA464211.1 - BU699409.1 - BY143226.1 - BE134712.1 - CA530764.1 - AL360872.1 - BY093521.1 - CJ150406.1 - BY297169.1 - AW411703.1 - BE854471
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4724789..4725141 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022181 (C6) NM_016704 complement component 6 Gene [Source:MGI Symbol;Acc:MGI:88233]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11860550..11860902 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000065979 (C530044N13Rik) NM_146067 RIKEN cDNA C530044N13 gene Gene [Source:MGI Symbol;Acc:MGI:2443300]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 14900440..14900792 329
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3031688..3032040 329
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 13845644..13845996 329
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 6761682..6762034 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002107 (Cugbp2) NP_001103702 CUG triplet repeat, RNA binding protein 2 Gene [Source:MGI (curated);Acc:Cugbp2-009]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5054882..5055234 329
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12252476..12252828 329
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3987226..3987578 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 9094783..9095135 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046178 (Nxph1) NM_008751 neurexophilin 1 Gene [Source:MGI Symbol;Acc:MGI:107492]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110424..5110776 329
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 6638188..6638540 329
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4182989..4183341 329
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4906326..4906678 329
NO GENE  

 
Come back to gene ENSMUSG00000046178


For any suggestions or comments, please send an email to unitrap@crg.es