Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13857B9
Clone ID IST13857B9
Vector VICTR74
Project tigm

Sequence tag IST13857B9HMF2
Sequence
GTGTCTTTAGAATTGAAAAAACGATGAGGGAGGGGCCCTATCTCGCCATTGATTCCACAGGTAAAACGGAAGCAGTANTA
TCTANTGTTAANAAAACCGGCAATCCATTAATTACTGCAGAAAGATGCAGGTTGGGTGACACAGGGAACACATAAAAGAA
AGGGGAAAGGGGGANACTGAGACTCCAGCGTTTGAAAGTGTATATCCGTCCAGATATTTGTANCAAATGGCAATCGGCTT
ANTGGAATGCCACCGTAATTCCACACTAAACAACGCANCAAGTCGGCCTCTTGGCGAGGGGCCGANTCCACCACCCGGGT
TCTTCCTANGACTGTTGGCCTGATGCTCCGGGATGTGCATCGCGGCCGCATGACTCCNANCCTGNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 90229527..90229910 360
NO GENE  


Sequence tag IST13857B9BBF1
Sequence
TTTATTATATGTAAGTACACTGTAGCTGTCTTCAGACA
Sequence Type genomic DNA
Unitrap ID UNI6743 UNI30852 UNI32547 UNI33535 UNI36053

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4676642..4676679 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 3145980..3146017 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015202 (Cnksr3) NM_172546 Cnksr family member 3 Gene [Source:MGI Symbol;Acc:MGI:2674130]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3228017..3228054 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053263 (OTTMUSG00000007639) predicted gene, OTTMUSG00000007639 Gene [Source:MGI Symbol;Acc:MGI:3649892]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3297041..3297078 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020671 (Rab10) NM_016676 RAB10, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105066]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3422714..3422751 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 4872427..4872464 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4420140..4420177 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049148 (Plcxd3) NM_177355 phosphatidylinositol-specific phospholipase C, X domain containing 3 Gene [Source:MGI (curated);Acc:Plcxd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3014548..3014585 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3386154..3386191 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3151703..3151740 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3064051..3064088 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3190282..3190319 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3116789..3116826 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3211833..3211870 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3144734..3144771 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3640654..3640691 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023964 (Calcr) NM_001042725 calcitonin receptor Gene [Source:MGI Symbol;Acc:MGI:101950]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3024134..3024171 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3020553..3020590 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3302184..3302221 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 309521..309558 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166313: 155987..156024 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166338: 4930..4967 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166402: 2085..2122 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166441: 236579..236616 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166451: 12509..12546 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166452: 18224..18261 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166458: 3877..3914 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166468: 48234..48271 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3093304..3093341 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 144698..144735 38
NO GENE  

 
Come back to gene ENSMUSG00000023964


For any suggestions or comments, please send an email to unitrap@crg.es