Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14963F7
Clone ID IST14963F7
Vector VICTR76
Project tigm

Sequence tag IST14963F7HMR1
Sequence
CTGCTGCATCTGTGGCATCAATCTCTTACCTTGTAGGGCTCCTCATAGGATTGCTTTATGTGGGACAGCTGTGACAGGGT
AGTGAGCTTCCTGTCCCTGTGATTGGTCCCAGAGAGACGGAGGGAGGAANCANAAACGCCAAACACATACACACACACAC
NCNNNCNCACACACACACACACACACACACACACACACACACACACACACNCNCN
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56864196..56864405 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]


Sequence tag IST14963F7HMF1
Sequence
GCAGAACTGGGGTTTTTCAACAGACAGAAGAGTGAACGTGGGAACAGACTCCTCAGGCCAGGTCAAGCCTTTACATTTCC
ATTGGCCCAGCCAAACACCTTTATTCAGTTTTGTGATGGACTTTGGTCCAGAGCCATTGTATAAACTAAACTACGACAGA
ATTCTTAGCTCACAGAAACTATAAGACAAATGTTTTGTTGTTTTAAGACAGTAAATTTGGGGTGATTTGCTAGGTATGAA
TGTGAGGTTCCCCCCACTCATACACACACACACACACTCNNGCGCGTGTGCTTGAACACTAATTCCCCANCNANTANCAC
TGTTTGGGAAGANTATANATACTTNNGGANNGTGGCTTNCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56864402..56864759 334
 
EST/CDNA Est Name
  CJ062365.1 - CJ067532.1 - CJ160054.1 - AW319020.1 - BB861699.1 - CJ094037.1 - CJ071087.1 - CJ071042.1 - CJ055446.1 - CJ071083.1 - CJ069307.1 - BY015634.1 - BY066912.1 - BY017544.1 - BY309516.1 - BY019096.1 - BY300501.1 - CJ055526.1 - BY016871.1 - CJ137696

 
Come back to gene CJ062365.1 - CJ067532.1 - CJ160054.1 - AW319020.1 - BB861699.1 - CJ094037.1 - CJ071087.1 - CJ071042.1 - CJ055446.1 - CJ071083.1 - CJ069307.1 - BY015634.1 - BY066912.1 - BY017544.1 - BY309516.1 - BY019096.1 - BY300501.1 - CJ055526.1 - BY016871.1 - CJ137696


For any suggestions or comments, please send an email to unitrap@crg.es