Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14473G2
Clone ID IST14473G2
Vector VICTR74
Project tigm

Sequence tag IST14473G2HMF1
Sequence
AGCCATCTCGCCAGCCCCTGTCTCTTTTCTTAGGAGGTAATGAGGCATGGTGGAAGAATTTCAGACCCAACAGGGACACA
ATCGAAAGTCTGTCTTCACTGAATCAGTTTATGTCGGGGAGAGACTAGGGCAGCAAAGCCAGCTGAGATAATGATAGCAG
CCCAGGTTAGAGAGTGTGAACTTGGCAGAANAAAAAATANGAANCAGAGGCACCANGGAAAAACGGGCNNNNNCTATTGG
TCTCNNTGCNCNNNGNTGCNCNGAGANTGTCNNANAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14473G2HMR1
Sequence
GGCTNAGTGGTTAAGAGCGCCGACTGCTCTTCTGAAGGTCCCGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACC
NTCCATAACGAAATCTC
Sequence Type genomic DNA
Unitrap ID UNI25304 UNI31969 UNI35465

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 30556624..30556719 92
 
EST/CDNA Est Name
  AA574776.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4084892..4084987 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020657 (Rbj) NM_153082 DnaJ (Hsp40) homolog, subfamily C, member 27 Gene [Source:MGI Symbol;Acc:MGI:2443036]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 91285397..91285492 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28172471..28172566 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021895 (Arhgef3) NM_027871 Rho guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:1918954]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102030443..102030538 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 8572575..8572670 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165860088..165860183 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30521376..30521471 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 84654839..84654934 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133282054..133282149 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 51273032..51273127 92
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 50386374..50386469 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039217 (Il18) NM_008360 interleukin 18 Gene [Source:MGI Symbol;Acc:MGI:107936]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 76542242..76542337 92
NO GENE  

 
Come back to gene ENSMUSG00000039217


For any suggestions or comments, please send an email to unitrap@crg.es