Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0487
Clone ID GC0487
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0487
Sequence
CTGGTCTCTGTTCATCTGAAAGAGAGTCTCTGAAATGGGAAGATGCAGTTTGACCTGCTCTGG
Sequence Type mRNA
Unitrap ID UNI298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108577962..108578024 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032846 (Zswim6) NP_663431 zinc finger, SWIM domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1914513]

 
Come back to gene ENSMUSG00000032846


For any suggestions or comments, please send an email to unitrap@crg.es