Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14744G1
Clone ID IST14744G1
Vector VICTR76
Project tigm

Sequence tag IST14744G1HMF1
Sequence
ATTTTATTTTGGTTTTTCGAGACAGGGTTTCTCTGTA
Sequence Type genomic DNA
Unitrap ID UNI9955 UNI33298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 115998111..115998147 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 57791802..57791838 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59661023..59661059 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44248354..44248390 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 70721918..70721954 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033510 (Otud7a) NM_130880 OTU domain containing 7A Gene [Source:MGI (curated);Acc:Otud7a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 108807513..108807549 37
NO GENE  

 
Come back to gene ENSMUSG00000033510


For any suggestions or comments, please send an email to unitrap@crg.es