Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12102E1
Clone ID IST12102E1
Vector VICTR76
Project tigm

Sequence tag IST12102E1HMF1
Sequence
NATGCTAATGAATGGATATACGCAGGTCAGGTTTTACNTANNGAATTAAAACCCCGGGTGCTGCANANATGGNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12102E1BBF1
Sequence
GCATGCTAATGAATGGATATACGCAGGTCAGGTTTTACATAAAGAATTAAGACCCCGGGTGCTGCAGAGATGGCTCAGCA
GTTAAGTGCACCGGTTGCTCTTCCAGAGGACCTGGATTTGATTCCCAGCACCCACATGGTAGCTCCAGTCCTAGGGAATC
TGACACCCGCTTCTGGCTCCCATGAAGGGCACTACAGTCAGGTTTTCCTTANTCTCACAGTTGCGGGGCTGAGGGCTCTG
ATTGACAGGAAGACATAGCACAAAAGGGCAGAGGTGTCTAGGACTCCTTCAAAACGTGTTGAAAATTCTGTCTTAACGCC
AAGCTGAAATTCATGGGATGAGGTTTTTTTGTTTTTGTTTTTGTTTTGTTTGTTTGTTTTTCGAGACAGGGTTTCTCTGT
AGCCCTGGCTATCCTGGAACTCACTTTGTANACNNNGCCGGCCTCNAACTCNNAAATCCGCCTGCCTCTGCCTNCCAAGT
GCTGGGATNNAAGGCNTGTGCCACCACNCCCANCTGANTTTTNAANTGTATGATN
Sequence Type genomic DNA
Unitrap ID UNI36056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122114807..122115340 500
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031831 (Lrrc50) NM_026648 leucine rich repeat containing 50 Gene [Source:MGI (curated);Acc:Lrrc50-001]

 
Come back to gene ENSMUSG00000031831


For any suggestions or comments, please send an email to unitrap@crg.es