Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14752B7
Clone ID IST14752B7
Vector VICTR76
Project tigm

Sequence tag IST14752B7HMR1
Sequence
CCTTTATCTGCTCACCCTCACTACAACCCAGTTATGTCTAGCCCCTTTACGTACCCATTTTACAGATGCGGATGCTGAGG
AACAAGGAGTATTGTGCTCANGGTTATTTATTAAGAACATTCAGGGTCAAGATTCAAACTCAGTCTGCTGAATTCTGTTT
CTGCATGACGTATGCTTCACCCATGGTGATAATCCATTTCAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 88146177..88146378 200
 
EST/CDNA Est Name
  CR514970.1


Sequence tag IST14752B7BBF1
Sequence
GAAAAAGTAAAATAATCGGAGCAGGCTGAATTCAGGGTGCTGTGTGTCACGTGGTTTGGGGGCGGGAGGAGAGAGAGCAC
AAAGACCCCTGCTGCCCATCACAGAGGCAAACCCTGGAATTGAATCCTGAAAGTATTTATTCATAAAGCCCTCAGGCTGG
AGAGCCGGGTGGGATCGGCCGCCTCAATCCTTTCCTCATTANCATTTTTATAGAGAAGAACTAAGAAATCAATTCAAGGT
CCTGGCTTATCCTTCTGGCCAGGTGGCTTTTGTCTCNCANGTNNCNNCN
Sequence Type genomic DNA
Unitrap ID UNI13863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84886636..84886917 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es