Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14631E5
Clone ID IST14631E5
Vector VICTR74
Project tigm

Sequence tag IST14631E5HMF1
Sequence
CTGCATGTCTAGCAGAAAGCTGATGTTCTTAGTCTATCTCCTGGGGTATTTGATATCAGTGTCTCTATTGACCACATAGC
CTCAATCCAACAAACACTACAGTATCTGCTGGGCTTTTTCCAGAAACTGCACGTTTTTCCTGCCAAAACTTATAAACACT
GGATACTTTGGGATAACGAAAATAGCAGACTGGAGGAGATATGACAACTAGAGTATGGAGTCTTGAATTACATCCTGAAA
CAAAACAAACAAAAGATGTCAGTGGGACATTGAAACGTGTGTATGGTCTTTATAATCTAGGTAACCTTCCTGTTAGCNNA
GANAGAAAATGAAGGGGAAGANGAAGCTCATTCAGTTTCTCTGAAATTCTTAACCNCNGACNNNCTCTGCAGGTGGACCT
NANANNGCTCATGNNNTGTGGGTTGCTGNGGACTCNGCTNNNGGGCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14631E5HMR1
Sequence
GCAGTGTATTCACGAGAACACGTCAGATGCAGGTGGGGAGGGGTGATGACTAGAATTCTGACNAGTACTGCTCGAGGTGA
GGGGCTCAGGGGAAACGGAGGGTCCAAGCCCAGGTTCTAGATGAATTCACAGCAGTGGTTTTACTAATGCCACCCCATGT
ANCTTANCCTGCTTTCTCAAAATCANATGTGCTATGGAAACTTANNGTGTATGGTTGAATGAATTACACGATGCNNGGCT
GACTATAAAGCCCN
Sequence Type genomic DNA
Unitrap ID UNI1163

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124477405..124477657 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025316 (Banp) NM_016812 BTG3 associated nuclear protein Gene [Source:MGI Symbol;Acc:MGI:1889023]

 
Come back to gene ENSMUSG00000025316


For any suggestions or comments, please send an email to unitrap@crg.es