Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15052F6
Clone ID IST15052F6
Vector VICTR80
Project tigm

Sequence tag IST15052F6BBF1
Sequence
AACCTAGAGCTCACTAGTCTGTCTAGATTGGCTGGCTAATGAGATCCAGTCAGTTACCTCCCTAGTGCTGAGATTATAGA
CACGTTCCTGGGGGCTGGGGACCTGACCTAAGGTCTTCATGATTTCACCGAGTGCACTTTACCAAACTGAGCCGTTTTCC
TGGCCCTTCAACTTTGAAGAATCAGAGAATGCAATATGTAAGGAGGGAAAAAGGTTCAGATGCAGAACCAATTAGACATG
TAATTCACCCATTTCTACTGATCAGGACTCAACCTGGGAGTTCTCTTTAGGCTGTGGCTTATCTTTCTTATTGAGTAAAG
GGTCAAGAAAATGGTATAAGCTGGCCTGGAACTCTTGATCCTCTCACTTCACCTTTCTTAGTGCTGGGCTTATATTACGC
CTTGTCACTTGGANGTANCTTTTTAAANAAATANCATTTGTATTTTANTTNNGNTACNGCNNTANNNCCNNGGGCCGTNG
CNCATGCTAANTGTGNGNNANATTNCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15052F6HMF1
Sequence
AACCTAGAGCTCACTAGTCTGTCTAGATTGGCTGGCTAATGAGATCCAGTCAGTTACCTCCCTAGTGCTGAGATTATAGA
CACGTTCCTGGGGGCTGGGGACCTGACCTAAGGTCTTCATGATTTCACCGAGTGCACTTTACCAAACTGAGCCGTTTTCC
TGGCCCTTCAACTTTGAAGAATCAGAGAATGCAATATGTAAGGAGGGAAAAAGGTTCAGATGCAGAACCAATTANACATG
TAATTCACCCATTTCTACTGATCAGGACTCAACCTGGGAGTTCTCTTTAGGCTGTGGCTTANCNTTCTTANNGANTAAAG
GGTCNAGAAAATGGTATAANCTGGCCTGGAACTCTTGATCCNNNNNNNTNNNNTTTCTNANNGCTGGGCTTATATTACNC
CNNGNCACNNNGAAGNANNNTTTTAAANAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15052F6HMR1
Sequence
GTNNANNGNNANACCCTGNNNNNNNNNTNNNNNNNGTGAGATCGAGGTCGAAGATACTCTCAAGCTAGCCTCTGGCCTCT
ACTTTCGTGTTAAGCC
Sequence Type genomic DNA
Unitrap ID UNI625

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 93835227..93835287 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039456 (Morc3) NP_001038994 microrchidia 3 Gene [Source:MGI Symbol;Acc:MGI:2136841]

 
Come back to gene ENSMUSG00000039456


For any suggestions or comments, please send an email to unitrap@crg.es