Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST450991
Clone ID OST450991
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST450991
Sequence
GACTGAGTGGGACCCAGCTCGGCTGAATGAATCTACCACCTTTGTTTTGGGGTCTCGAGCCAACAAGGCCTTGGGGATGG
GAGGCACCAGAGGGAGAATCTACATCAAGCACCCACACCTCTTTAAGTATGCAGCAGATCCTCAGGACAAGCACTGGCTG
GCTGAGCAGCATCACATGCTGGGCAACAGGCGGAAAGATGGCGTACCTTCTCATTGAAGAAGACATCCGGGACTTGGCTG
CCAGCGATGACTACAGAGGATGCTTGGACCTGAAGTTGGAGGAGCTGAAATCCTTTGTTCTGCCATCCTGGATGGTTGAG
AAGATGCGGAAATACATGGAGACACTGCGGACAGAAAATGAGCACCGCGCTGCGGAAGCGCCTCCCCAGACCTGAGCCGG
GTGTCCTGGCTACTACACTTGGCGGCCTGCCTCCAAGACCCTCTTTCCCCACCCGGCTGAGGCCATCATGGGGATTTGGT
CTAGTTGACTCTTAACAGCATTAAGCTCCC
Sequence Type mRNA
Unitrap ID UNI17009

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164588567..164593613 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017299 (Dnttip1) NM_133763 deoxynucleotidyltransferase, terminal, interacting protein 1 Gene [Source:MGI (curated);Acc:Dnttip1-001]

 
Come back to gene ENSMUSG00000017299


For any suggestions or comments, please send an email to unitrap@crg.es