Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10070C8
Clone ID IST10070C8
Vector VICTR75
Project tigm

Sequence tag IST10070C8BBF1
Sequence
CTGGTTCAGGGAAGCCCGAGTTTTTTGAAGGCCTGTCAAGAGTAGGGCAAGTATGATCTGGCTTTGGGGACCTCTATAGA
TTTCAGAGATTAGAATCTTCCTTTTACCAAGGTCCCCACTGAAGCTTTCTTCTTTTTCTAATATATTATCCTTATTAAAA
AAACAACACACACAGAGGAGAGAGAGAATATGCACAATTGCTCAGTGATTCATTTGGGGAAAAAAAATCCCAAACTGCTT
TTCTTTTTTTTCTTTTTTTGGTTTTTTGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTCAAACACAGAAATCCGTC
TGCCTCTTCCTCCCAAGTGCTGGGATTAAAGGTGTGCGCCACTACTGCCCAGTGACAGTTGTTGTTTTTTTTTTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152620544..152620938 393
 
EST/CDNA Est Name
  AI180733.1 - BE571429.1 - DT926332.1 - CF725764.1 - AA823283.1 - AI323048.1 - AA051441.1 - DT922788.1 - W97433.1 - CA546825.1 - BY017191.1 - CF170305.1 - DT928753.1 - CA884244.2 - CF166076.1 - BQ558343.1 - CD543337.1 - CA873894.1


Sequence tag IST10070C8HMR1
Sequence
CCAGCTGCATCTAGTGAGCACTAACGGAAAGCCCTTGTATTTTCTTTCNTGCAACCAAGCATGGAGATGTAGGTCAGGCA
CTGCTGGCCTGGCAGTTACAGCAATTCTGGCTTTGCCCTGCACCTGCAGCCATGTTCTCAGAGACCCATCGGGTAGGGAA
GGGATAGGATCTTCAAGAGCTTGTGGGTGGAGCTGGCTGGATCAAGCAGAGGGTCCTCAGAAAAGACCATCTGGAATGTG
GGGCCTGAGAAGATGGCTCTGCCCAGGCGTGTCTGTGGCTTCTGTTCAGCTTAGTGTCATCATCATTGATGGAGGAGACT
GGGGAGGTCCCATTCTCCTGCTGAGCTN
Sequence Type genomic DNA
Unitrap ID UNI16383

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152620201..152620547 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007659 (Bcl2l1) NM_009743 BCL2-like 1 Gene [Source:MGI (curated);Acc:Bcl2l1-001]

 
Come back to gene ENSMUSG00000007659


For any suggestions or comments, please send an email to unitrap@crg.es