Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13077C4
Clone ID IST13077C4
Vector VICTR76
Project tigm

Sequence tag IST13077C4HMR1
Sequence
AAAGACGAACGGGACTACAATTCCCATCAGCCGATTCCCTTAGCTGCTTGAGCCAGGGTGATGGGGATTGTAGTCCNNTN
TACTGAGGGGCGGCTAGGGCGGCCCAGGCGTACGTCCTCGGGGTGACCTTCTGATTGATCCCCACAGCTACCACCTGGTT
GGGATCAGCTTCTTCATTCTGGGACTGGGCACCCTTCTCCCCTGGAACTTCTTCATTACCGCCATCCCGGTGAGACCCGC
GGCCGCTGGGCAACCTCAT
Sequence Type genomic DNA
Unitrap ID UNI36058

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5024364..5024622 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024891 (Slc29a2) NP_031880 solute carrier family 29 (nucleoside transporters), member 2 Gene [Source:MGI Symbol;Acc:MGI:1345278]


Sequence tag IST13077C4HMF1
Sequence
CTTTGAGCCCAGGAGCATCAAGACGAGCGGGAATTCAAAGGCTCGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5024320..5024367 48
NO GENE  

 
Come back to gene ENSMUSG00000024891


For any suggestions or comments, please send an email to unitrap@crg.es