Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14731F1
Clone ID IST14731F1
Vector VICTR76
Project tigm

Sequence tag IST14731F1BBF1
Sequence
CTCACCAGCATCATCAATGTATGTAAAGGCCATGTGGTTAGTCCCACTCCTGGGTCCGGAAACCAATGGACTTGACTCTC
AGANAGCACGCCCACAGCTAGAGCCACTCCCACAGGACCCCCAGCTCTCAGGTGTCCTCTCTACAAGGTTTCAACAGGAT
GGTTGGCAGGGAGTCTGGAATCCGGTTAGACCGGATTCTCCCTGCCATCCTGCTGGCTTTGGAATTCAGCCACTTCAGTG
AAACTGGGGGAGAAAGGGTCAGTCCTGTCTGAACCAGTAGGTCTTTCAAAGTANCCTCCTCTTCCCTTACCCCATTTCCA
AGACGATGGGGCCTGGCCAAGGTCACACCGAGTGGGCAATGGCACTGTTAACTCTTTTACCTGCTTCCTTTTATGACTCN
AANANGTTTTGAGTACAGGACTTGGGTCGGTCGGATANAAGTCTCCCCACCTCCTANNCAACGATGATAAGTGTCCTTGA
NATGTNACTTGGGAGTTTACCNNANATGACAACTCNNACACAGTTTATTGANAGTCTTTNNTCNNNCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3842347..3842885 507
 
EST/CDNA Est Name
  BG298636.1 - BY734825.1


Sequence tag IST14731F1HMR1
Sequence
GTGAGGTCTAACTGTCCTGGATGGAAAAGAGTCTGTTCTTAAGCAGCTTCGGTTTTGTTTGTTTGGTTGGGGTTTTTTGT
TTGTTTTTTGTTTTGGTTTTTCGAGACAGGGTTTCTCTGTGTANCCTTGGCTGTCCTGGAACTCACTTTGTC
Sequence Type genomic DNA
Unitrap ID UNI31190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3842201..3842351 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000082848 (AC133523.2)  


Sequence tag IST14731F1HMF1
Sequence
CTCACCAGCATCATCAATGTATGTAAAGGCCATGTGGTTAGTCCCACTCCTGGGTCCGGAAACCAATGGACTTGACTCTC
AGAGAGCACGCCCACAGCTAGAGCCACTCCCACAGGACCCCCAGCTCTCAGGTGTCCTCTCTACAAGGTTTCAACAGGAT
GGTTGGCAGGGAGTCTGGAATCCGGTTAGACCGGATTCTCCCTGCCATCCTGCTGGCTTTGGAATTCAGCCNCTTCAGTG
AAACTGGGGGANAAAGGGTCAGTCCTGTCTGAACCANTANGTCTTTCNAAGTANCCTCCTCTTCCCTTACCCCATTTCCN
AGACNATGGGGCCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3842347..3842682 320
NO GENE  

 
Come back to gene ENSMUSG00000082848


For any suggestions or comments, please send an email to unitrap@crg.es