Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0488
Clone ID GC0488
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0488
Sequence
CGCCATTGAGTGGCGAGGGGGTGAGGGGGTTGACGGTGGCGGTGGTCCTGGTCGCCGTGGAAAGCATCCCTATGGAAGGG
GACTTGGGCTCATGGCTCATGCCTGCGGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGATCA
TCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTG
Sequence Type mRNA
Unitrap ID UNI299

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123077481..123077585 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es