Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0687
Clone ID AY0687
Vector pGT0lxr
Project sanger

Sequence tag AY0687
Sequence
AGCTTGAAGACGAGATAAGGAGACTTCATGACTTCAACAGAGATCTCCGAGATCGACTGGAGACAGCCAACAGGCAGCTG
TCCAGCAGGGAATACGATGGGCATGAAGACAAAGCTGCAGAGAGCCATTACGTGTCCCAGAACAAAGAATTCTTGAAGGA
AAAGGAAAAGTTGGAAATGGAGTTGGCAGCAGTGCGTACGGCAAGTGAGGACCATCGGAGGCACATCGAGATCCTGGACC
AGGCTTTGAGCAATGCGCAGGCTAGAGTGATCAAACTGGAGGAAGAGTTACGAGAGAAGCAAGCCTATGTGGAAAAGGTG
GAGAAGCTGCAGCAGGCCCTGACCCAGCTGCAGTCAGCGTGCGAGAAGCGAGGGCAGATGGAACGCAGGTTGCGGACCTG
GCTGGAGAGGGAGCTAGACGCTCTGAGGACACAGCAG
Sequence Type mRNA
Unitrap ID UNI3218

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14362903..14377169 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013076 (Amotl1) NM_001081395 angiomotin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1922973]

 
Come back to gene ENSMUSG00000013076


For any suggestions or comments, please send an email to unitrap@crg.es