Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST450885
Clone ID OST450885
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST450885
Sequence
GGGTCCTGGAGTCCCCGAGCTCGGCAGCTCCTGGAGCGGCTGGATGCTGCGCCCCCTGGCGGCACGAGCCGCCGCGGACT
TGACAGCGCTAGTACGAAAAGCGGGCGCCACATTGCGCCTGNGCCACACAGGAGGGTGTTAGTGGTCTGGATTCTGCAGA
TATAGAAGTCACAGACAGTCGCTTGCCTCATGCTACTCTTGTGAAACATCGACCCCAGCATCAAAGGTCTGAGACTNTAG
GNACATGGACGGAGCCNCNTTCCAGNAACCCAGAATAAGGCAAGCTATGCTTTGAAAGTACCCCAAGCCACTGGCCGATT
TTCTGTGGAGCTGACCCGAGGTCCGGCAGGTTTTGGTCTTACTTTAAGTGGAGGCCGAAATGTATCTGGGGATGCTCCAT
TGACCGNGCATGGACTGCTGAAGGATGGGCCAGCACAG
Sequence Type mRNA
Unitrap ID UNI17014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7253244..7257158 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031147 (Magix) NM_018832 MAGI family member, X-linked Gene [Source:MGI (curated);Acc:Magix-001]

 
Come back to gene ENSMUSG00000031147


For any suggestions or comments, please send an email to unitrap@crg.es