Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13021A6
Clone ID IST13021A6
Vector VICTR76
Project tigm

Sequence tag IST13021A6HMR1
Sequence
TACAGAGTGAGTTCCAGGACAGCCNGGGCAACACAGAGAAACCCTGTCTCGA
Sequence Type genomic DNA
Unitrap ID UNI1116 UNI35578 UNI36065 UNI36066

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10627696..10627747 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 31895204..31895255 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 8836503..8836554 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 10423579..10423630 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022248 (Rad1) NM_011232 RAD1 homolog (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1316678]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8696987..8697038 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 25896177..25896228 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 95718535..95718586 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049493 (Pls1) NM_001033210 plastin 1 (I-isoform) Gene [Source:MGI Symbol;Acc:MGI:104809]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 26691333..26691384 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 32398285..32398336 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029765 (Plxna4) NM_175750 plexin A4 Gene [Source:MGI (curated);Acc:Plxna4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140378321..140378372 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 89698098..89698149 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155964121..155964172 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027618 (Nfs1) NM_010911 nitrogen fixation gene 1 (S. cerevisiae) Gene [Source:MGI (curated);Acc:Nfs1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 50585990..50586041 50
NO GENE  

 
Come back to gene ENSMUSG00000027618


For any suggestions or comments, please send an email to unitrap@crg.es