Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11668C9
Clone ID IST11668C9
Vector VICTR76
Project tigm

Sequence tag IST11668C9HMF1
Sequence
NTCTGAGGGAAAAATATTCTAGATAGAAAGAAAAGCAGACTCCAGGGTGGGAAAGGGACCCACATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157203994..157204059 64
NO GENE  


Sequence tag IST11668C9BBF1
Sequence
ATCTGNNGGAANAATATTCTAGNTAGAAAGAAAAGCAGACTCCAGGGTGGGAAAGGGACCCACATGGCCAGGAAGGGAAA
CTGGAAGATGCGGANATGGGATGGAACATAAACAAACCTTGGAAGACCCANCCCCGTTTAACTTGACCAAGTAAAAAGTA
AAGCANAGAAAAGCGCTAAGTTCTAAATTGCTCATTGTTGCTGTTATTTTATTTATTTATTTATTTACATTTTGGTTTTT
TGTTTTGTTTTCCAAGACAGTCCCTTTAAGCAGCCCTGGCTATCCTGGAACTCAGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157203759..157204060 288
 
EST/CDNA Est Name
  W80148.1


Sequence tag IST11668C9HMR1
Sequence
GATTACAAGTGTGAGTCACTCTACTTCTGCCCTGTTCCCATCTCTGTTTACTTTTATAAGACCTGTGGCATCCACAGAGG
TCTCCCCTCCCACCCCATATGAGATCAACCGTCTCCCGAACAGTTTCTCTCCCCCTGCAGCCTGGCTCTGTGGTCTGCTG
TCTGCCTGCATTCGGAGCANAGCTTTGAGAGCANGCATTANCCTGTCTCTTTTTCTTCANCCTTTGGTATCCCTAAGTGT
TACATCACNAAGTGAATGAATAGACAGAGTCAGCCAGGTAGTCGGTGTTCCTGAGCTGGTAGGGTGCTTGCTCANCATTC
NTGANGCCCTGGGTTCCANCCCCACACTTANGGCAGAAGCAGATCN
Sequence Type genomic DNA
Unitrap ID UNI11614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157204058..157204422 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063019 (Manbal) NM_026968 mannosidase, beta A, lysosomal-like Gene [Source:MGI (curated);Acc:Manbal-001]

 
Come back to gene ENSMUSG00000063019


For any suggestions or comments, please send an email to unitrap@crg.es