Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14565C12
Clone ID IST14565C12
Vector VICTR74
Project tigm

Sequence tag IST14565C12HMF1
Sequence
GCGTCTTGACACAAGGGTCTCTCACTAGTGTGGAGCTCAACAACTGAGCTGAACTGATTGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121210973..121211037 65
NO GENE  


Sequence tag IST14565C12HMR1
Sequence
ACGCGAGGCAGANAGTTTCTAAGGAATGACCCTTGAGGTCGTCATCTGGCCTCCATATGCACACGCATGTACCCACGTGA
ACACACATATGCACATCATCCATACACTAACATTA
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121211034..121211148 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]


Sequence tag IST14565C12BBF1
Sequence
GCGTCTTGACACAAGGGTCTCTCACTAGTGTGGAGCTCAACAACTGAGCTGAACTGATTGGCCAGAGAGCCCCAGGGATC
T
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121210958..121211037 80
NO GENE  

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es