Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST450788
Clone ID OST450788
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST450788
Sequence
GCAGACCTGAGCCCAGTCCCCTTCCTAGGGATGCTTTCCACGGCGACCAGGACCACCGCCACCGTCAACCCCCTCACCCC
CTCGCCACTCAATGGCGCCCTGGTGCCCACCGGTAGCCCGGCCACCAGCAGTACGCTGTCGGCCCAGGCCGCTCCATCCT
CCAGCTTTGCTGCCGCACTGCGCAAGCTCGCCAAACAGGCAGAGGAGCCCAGAGGGAGGAGA
Sequence Type mRNA
Unitrap ID UNI17018

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123077489..123077709 205
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es