Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12838F2
Clone ID IST12838F2
Vector VICTR76
Project tigm

Sequence tag IST12838F2HMR1
Sequence
ATGTTTTTAATACACTCTGTTTCAAACGCCTGCACTGCACAGGTTAGTCNTGTGACAGACTCATGCCTCANAGTCATGGG
GTTAAATGGAACACCAGTACTGTTTTCCTGCTTAGGTTATGAAGTAGTCCTTCCAAATGCTGACATGCTTGTAGCTCCTG
TCATCTAATCACAAGTGAGCTACTGAGAAGAAAAAATANGACATGGANAGGATTTTCTTGGANGANTTCCTTCTGGGAGG
TCN
Sequence Type genomic DNA
Unitrap ID UNI15801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107759224..107759465 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es