Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12233A5
Clone ID IST12233A5
Vector VICTR76
Project tigm

Sequence tag IST12233A5HMF1
Sequence
CAGTGACACATATCAGAGAACCTCTGTGCACACTCTCTGAAATGGCGCTTATTCCCTTTCACCTGATTATGTCACTTATT
ACCAGTTGTGATCTTTTTAAGCACATGACTTCTGATGATAAACGCGTGCTGTGCCGTAGCACCTGAACCCTCTAAACAAC
CAGGATTTTTCTTTCTTTCCTTTTCTTTCTTTCCCCCTCTCTCTCTTTCTTTCTTTCTTTTTCTTTTTTTGATACTGACT
CCCAGGTTTCCCAAAAGATCCTGTANATGAAGAGTTCTGTGCCTGGACTGCCCCTATTTCAGATTCCAGCAACCAATAGG
GCTCCCAGGCATCCAGTGCTTCTGTTTAGGATACTTCAAATATGTGGGTGTCTCTGGTTCCCCTTTCAGGTTCAGTANAG
CACTCTCTTTGTTTGCATTTCCCAAATCATTGGAAAGGTCAAGGCTCAGGAATGGA
Sequence Type genomic DNA
Unitrap ID UNI36068

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 170596147..170596601 451
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027560 (Dok5) NM_029761 docking protein 5 Gene [Source:MGI (curated);Acc:Dok5-001]


Sequence tag IST12233A5BBF1
Sequence
CAGTGACACATATNAAANAACCTCNGNGCACACTCTCTGAAATGGCGCTTATTCCCTTTNANCTGATTATGTCACTTATT
ACCAGTTGTGATCTTTTTAANCACATGACTTCTGATGATAAACGCNTGCTGTGCCGTAGCACCTGANCCCTCTAAACAAC
CNNGATTTTTCTTTCTTTCCTTTTNTTTCTTTCCCCCTNTCTCTCTTTCTTTCTTTCTTTTNNNNNTTTTGATACTGACT
CCCAGGTTTCCCAAAAGATCCTGTANATGAAGAGTTCTGTGCCTGGACTGCCCCTATTTCANATTCCAGCAACCAATAGG
GCTCCCAGGCATCCAGTGCTTCTGTTTAGGATACTTCAAATATGTGGGTGTCTCTGGTTCCCCTTTCAGGTTCAGTANAG
CACTCTCTTTGTTTGCATTTCCCAAATCATTGGAAAGGTCAAGGCTCANGAATGGCCNGATGGAATGAATACCCANGGCT
GGTTCTGACAGCCTTGCACGTCCTATGTCCTCTCTGGCGTGCTACTTTCTCTGTTNNCACACCCGGAAGCGTCTTGANTC
CTGTCGTTTAANANTTTCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027560


For any suggestions or comments, please send an email to unitrap@crg.es