Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15059E9
Clone ID IST15059E9
Vector VICTR80
Project tigm

Sequence tag IST15059E9HMR1
Sequence
CTCTTTGAAGATATANNNNNNTCACATCACACTCAAGCCTCTGCCAACGAGTTTTCTACTTCTGTTCAACAAACTACCCA
AGCTGAGCAGCTCCAAACAACAGCCAGTTATGATCCTCACAGTCCGGTGGGTCAGAAGCCTAAGCGGGCGTGGCTACCTC
GCTGCTATTGCCTGACCCTGCTCGGTGCATCCACATTCACATCCTTTCCTGGTGAGTGTGGTTCTTTGACTGGTTTTGTT
CCAATTTTTAGTATATGTGCTGCTGAAACAATCTTTTTGCCTCTGCCTCCAGACTGCAGGGATTAATGTTCTTGACTGCC
ACAGAGCACTAATATTTACTGAACATGTGATCATGTGGTGCTCAGCACTCTTGCACCCAANGCTCGGGGAACATGGAGGA
AGANGGGGTGGAAAGANTCCNGAACCNGAGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75164243..75164675 407
NO GENE  


Sequence tag IST15059E9HMF1
Sequence
AAACTAAGCCTGCAGGATAAAGCCATCCAACTGTATGTTTTTCTCCTAGGACCACAGCTAAGGATGGCTTTTTACCAGAT
AAAAGTTTGCAGTTGATTTTAAGATAAAGAGCACTGGA
Sequence Type genomic DNA
Unitrap ID UNI21618

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75164684..75164800 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018809 (Smyd4) NP_001096081 SET and MYND domain containing 4 Gene [Source:MGI (curated);Acc:Smyd4-001]

 
Come back to gene ENSMUSG00000018809


For any suggestions or comments, please send an email to unitrap@crg.es