Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11858H2
Clone ID IST11858H2
Vector VICTR76
Project tigm

Sequence tag IST11858H2BBF1
Sequence
TTGGCATCAAAAGGTTCTCTACCAAACTGANTCCTATCCCGTCGTGTTTTTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI17299

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21265769..21265825 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]


Sequence tag IST11858H2HMF1
Sequence
TTGGCATCAAAAGGTTCTCTACCAAACTGAGTCCTATCCCGTCGTGTTTTTCAGATCTATTGTTGTAAGGTGCATGCGTG
TGGATGCGTGTAGAGTCCGTGGTGTTGGATCCTCCTGAGCTGGAGCTGCTGGTGTCATGAGCCTCCTGACAAGGGTGCTG
AGCACCAGGCAGTTTCCCTCAGGAGCAGTAGTCAGTCATGACTGTCGGGCCAACTCTCCAGCCTCCTTGTGGTTTGTTTG
AGACTGGAACTTATGGCCTTCATTCGAACCCTCAAGGTTCACAGAAGGTTCACAGATCCTATTTGGTTGTTGGTTGTGTC
CGANGGTCTTTAACATGTGTCTGAGCACCCAGGCATTCTTGTCCAGACATGCATGCCAATACCAAATCTGAANAAGGCAG
ANCTTGTGGGCGTGNNCATCAGGAGCCTGTCACCNTGGTTTCCTCNTN
Sequence Type genomic DNA
Unitrap ID UNI17299

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21265769..21266212 432
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033335 (Dnm2) NP_001034609 dynamin 2 Gene [Source:MGI Symbol;Acc:MGI:109547]

 
Come back to gene ENSMUSG00000033335


For any suggestions or comments, please send an email to unitrap@crg.es